PARC MEDIA GROUP
"THE VOICE THE WORLD HEARS, THE ONE THAT CARES" (C)2022/2029- Broadcasting From Japan,UK, Russia,and Saudi Arabia
Coronavirus Origin Timeline:What You Really Should Know
Warren D. Ward, 48, was in high school when the swine flu threat of 1976 swept the U.S. The Whittier man remembers the episode vividly because a relative died in the 1918 flu pandemic, and the 1976 illness was feared to be a direct descendant of the deadly virus.
“The government wanted everyone to get vaccinated,” Ward said. “But the epidemic never really broke out. It was a threat that never materialized.”
What did materialize were cases of a rare side effect thought to be linked to the shot. The unexpected development cut short the vaccination effort -- an unprecedented national campaign -- after 10 weeks.
The episode triggered an enduring public backlash against flu vaccination, embarrassed the federal government and cost the director of the U.S. Center for Disease Control, now known as the Centers for Disease Control and Prevention, his job.The pandemic fears of the time and the resulting vaccine controversy may be fueling some of the public’s -- and media’s -- anxiety about the current outbreak, said health officials who recalled the previous event.
Ward said his family discussed the vaccine in 1976 and decided not to get it. If a vaccine is ordered for this latest threat, he said, “I’m not getting it. I felt back then like it was a bunch of baloney.”
The swine flu brush of 1976 -- some call it a debacle -- holds crucial lessons for the government and health officials who must decide how to react to the new swine flu threat in the days and weeks ahead.
For starters, officials must keep the public informed. They must admit what they know and don’t know. They must have a plan ready should the health threat become dangerous. And they must reassure everyone that there is no need to worry in the meantime.
It’s a tall order. Doubts about the government’s ability to handle a possible flu pandemic linger, said Dr. Richard P. Wenzel, chairman of internal medicine at Virginia Commonwealth University, who diagnosed some of the early cases in 1976.
“I think we’re going to have to be cautious,” Wenzel said. “Hopefully, there will be a lot of good, honest public health discussion about what happened in 1976.”
Officials should be prepared for plenty of second-guessing, especially for any decisions regarding vaccination, which was at the core of the 1976 controversy, said Dr. David J. Sencer, the CDC director who led the government’s response to the threat and was later fired.
“There were good things and bad things about it,” said Sencer, who is retired and lives in the Atlanta area. “People have to make science the priority. They have to rely on science rather than politics.”
The question of whether politics overtook science in 1976 has been the fodder of books, articles and discussions for 33 years.
The panic in 1976 was partly because of the belief -- now known to be erroneous -- that the 1918-19 flu pandemic, which killed half a million Americans and as many as 50 million worldwide, was caused by a virus with swine components. Recent research suggests instead that it was avian flu, but that seems unlikely to assuage the current anxiety.
The episode began in February 1976, when an Army recruit at Ft. Dix, N.J., fell ill and died from a swine flu virus thought to be similar to the 1918 strain. Several other soldiers at the base also became ill. Shortly thereafter, Wenzel and his colleagues reported two cases of the flu strain in Virginia.
“That raised the concern that the original cluster at Ft. Dix had spread beyond New Jersey,” said Wenzel, former president of the International Society for Infectious Diseases.
At the CDC, Sencer solicited the opinions of infectious disease specialists nationwide and, in March, called on President Ford and Congress to begin a mass inoculation.
The $137-million program began in early October, but within days reports emerged that the vaccine appeared to increase the risk for Guillain-Barre syndrome, a rare neurological condition that causes temporary paralysis but can be fatal.
Waiting in long lines at schools and clinics, more than 40 million Americans -- almost 25% of the population -- received the swine flu vaccine before the program was halted in December after 10 weeks.
More than 500 people are thought to have developed Guillain-Barre syndrome after receiving the vaccine; 25 died. No one completely understands the causes of Guillain-Barre, but the condition can develop after a bout with infection or following surgery or vaccination. The federal government paid millions in damages to people or their families.
However, the pandemic, which some experts estimated at the time could infect 50 million to 60 million Americans, never unfolded. Only about 200 cases of swine flu and one death were ultimately reported in the U.S., the CDC said.
The public viewed the entire episode as political farce, Sencer said. But at the time, he said, the government erred on the side of caution.
“If we had that knowledge then, we might have done things differently,” Sencer said. “We did not know what sort of virus we were dealing with in those days. No one knew we would have Guillain-Barre syndrome. The flu vaccine had been used for many years without that happening.”
Wenzel also recommended vaccination in 1976. “It was a great effort,” he said. “It just had unexpected, unfortunate side effects.”
In Mexico, where 22 people have died from the current swine flu outbreak, government officials are under fire for their handling of the situation. But people fail to understand the challenges faced by health officials with such a mysterious threat, said Dr. Peter Katona, an infectious disease expert at UCLA.
“You have to look at not only 1976 but 1918,” he said. “The pandemic flu that occurred in 1918 lasted a year and a half. In 1976, we didn’t know what was going to happen. The virus might burn out. It might proliferate. These viruses have a mind of their own, and we don’t know how to predict what will happen.”
CDC officials have been wisely circumspect in their comments about the current outbreak, Sencer said.
“I like the fact that they have said, ‘We may change our minds,’ ” he said. “Don’t expect health officials to have the answers overnight. These things need time to be sorted out. We’re still in the learning curve.”
Dr. Richard Krause, who headed the National Institute of Allergy and Infectious Diseases in 1976, has noted drolly that public health officials involved in the next pandemic flu threat “have my best wishes.”
Background A novel A/H1N1 was identified in the human population in North America in April 2009. The gene constellation of the virus was a combination from swine influenza A viruses (SIV) of North American and Eurasian lineages that had never before been identified in swine or other species.
Objectives The objectives were to (i) evaluate the clinical response of swine following experimental inoculation with pandemic H1N1 2009; (ii) assess serologic cross‐reactivity between H1N1 2009 and contemporary SIV antisera; and (iii) develop a molecular assay to differentiate North American‐lineage SIV from H1N1 2009.
Methods Experiment 1: Weaned pigs were experimentally infected with A/California/04/2009 (H1N1). Experiment 2: The cross‐reactivity of a panel of US SIV H1N1 or H1N2 antisera with three isolates of pandemic A/H1N1 was evaluated. Experiment 3: A polymerase chain reaction (PCR)‐based diagnostic test was developed and validated on samples from experimentally infected pigs.
Results and Conclusions In experiment 1, all inoculated pigs demonstrated clinical signs and lesions similar to those induced by endemic SIV. Viable virus and antigen were only detected in the respiratory tract. In experiment 2, serologic cross‐reactivity was limited against H1N1 2009 isolates, notably among virus antisera from the same HA phylogenetic cluster. The limited cross‐reactivity suggests North American pigs may not be fully protected against H1N1 2009 from previous exposure or vaccination and novel tests are needed to rapidly diagnose the introduction of H1N1 2009. In experiment 3, an RT–PCR test that discriminates between H1N1 2009 and endemic North American SIV was developed and validated on clinical samples.
Introduction
In March–April 2009, a novel pandemic H1N1 emerged in the human population in North America. The gene constellation of the emerging virus was demonstrated to be a combination of genes from swine influenza A viruses (SIV) of North American and Eurasian lineages that had never before been identified in swine or other species. The emergent H1N1 quickly spread in the human population and the outbreak reached pandemic level 6 as declared by the World Health Organization on 11 June 2009. Although the eight gene segments of the novel virus share lineage with available sequences of corresponding genes from SIV from North America and Eurasia, no closely related ancestral SIV with this gene combination has been identified in North America or elsewhere in the world. Other than sporadic transmission to humans, SIV of the H1N1 subtype historically have been distinct from avian and other mammalian H1N1 influenza viruses in characteristics of host specificity, serologic cross‐reactivity, and/or nucleotide sequence. Since 1997–1998 in North America, multiple subtypes of endemic SIV (H3N2, H1N1, and H1N2) co‐circulate in most major swine producing regions of the USA and Canada (reviewed in Ref. 6). The North American SIV have a triple reassortant internal gene (TRIG) constellation consisting of six genes excluding the surface glycoproteins, hemagglutinin (HA), and neuraminidase (NA), with the six TRIG genes being derived from swine, avian, and human influenza viruses. Additionally, introduction of H1N1 and H1N2 viruses with the HA and NA genes originating from contemporary human seasonal influenza A viruses (hu‐like H1) that are genetically and antigenically distinct from the classical swine H1 lineage were reported in pigs in Canada. The viruses identified in Canadian pigs were human virus lineage in entirety or double (human‐swine) reassortants. Since 2005, hu‐like H1N1 and H1N2 viruses have emerged in swine herds across the USA as human‐swine reassortants possessing the TRIG. Four phylogenetic clusters (α, β, γ, and δ) of H1 SIV are now endemic in US swine. However, to date, Eurasian lineage SIVs have not been reported in the USA, thus the potential impact of transmission of the pandemic H1N1 virus to the US pig population is unknown.
In experiment 1, weaned pigs were experimentally inoculated with A/CA/04/2009 H1N1 to evaluate clinical signs and lesions during acute infection with the human pandemic virus in the swine host. As North American lineage H1 SIV are endemic in the USA, it is also important to understand the role that existing herd immunity against endemic swine H1 may play in protecting the swine population from the human pandemic H1N1 2009. The serologic cross‐reactivity of a panel of swine antisera generated against H1N1 or H1N2 SIV was investigated against three novel human A/H1N1 isolates in experiment 2 to predict the susceptibility of pigs with pre‐existing immunity against North American lineage H1 swine viruses against the pandemic H1N1 2009. To rapidly differentiate the novel H1N1 from endemic North American H1 SIV, in experiment 3 a restriction fragment length polymorphism (RFLP) developed for the matrix (M) gene was evaluated for use as a method of discriminating H1 genotypes in swine specimens.
A/California/04/2009 (CA/09) (cell passage 1), A/New York/18/2009 (NY/09) (egg passage 3), and A/Mexico/4108/2009 (MX/09) (egg passage 2) received from the Centers for Disease Control and Prevention (CDC) were propagated in Madin–Darby Canine Kidney (MDCK) cells for use in the studies described below.
In experiment 1, four 5‐week‐old cross‐bred pigs from a herd free of SIV and porcine reproductive and respiratory syndrome virus (PRRSV) were housed in ABSL3 isolation and cared for in compliance with the Institutional Animal Care and Use Committee of the National Animal Disease Center. Pigs were inoculated intra‐tracheally with 2 ml of 1 × 105 50% tissue culture infectious dose (TCID50) of CA/09 (H1N1)v as previously described. 9 Four additional age‐ and source‐matched pigs were maintained as negative controls. All pigs were screened for influenza A nucleoprotein antibody by ELISA (MultiS ELISA; IDEXX, Westbrook, ME, USA) before the start of the study to ensure absence of prior immunity. Pigs were observed twice daily for signs of clinical disease and fever. Nasal swabs (Fisherbrand Dacron swabs; Fisher Scientific, Pittsburg, PA, USA) were taken and placed into 2 ml minimal essential medium (MEM) on 0, 1, 2, 3, 4, and 5 days post‐infection (dpi) to evaluate nasal virus shedding and stored at −80°C until study completion. Pigs were humanely euthanized with a lethal dose of pentobarbital (Sleepaway; Fort Dodge Animal Health, Fort Dodge, IA, USA) on 5 dpi to evaluate lung lesions and viral load in the lung and other selected tissues. Fresh samples were taken from lung, tonsil, inguinal lymph node, liver, spleen, kidney, semitendinosus skeletal muscle (ham), and colon contents (feces) using individual sterile instruments for each tissue. Fresh necropsy samples were stored at −80°C until processed for downstream assays. Additional samples of the same tissues were fixed in 10% buffered formalin and processed by routine methods for histopathologic and immunohistopathologic examination. Immunohistochemical methods for the detection of influenza antigen in tissues using monoclonal antibody against type A nucleoprotein were employed as previously described. 10 Bronchoalveolar lavage fluid (BALF) samples from 5 dpi were screened for aerobic bacterial growth on blood agar and Casmin (Nicotinamide adenine dinucleotide (NAD) enriched) plates. Diagnostic polymerase chain reaction (PCR) for PCV2 11 and Mycoplasma hyopneumoniae, 12 or an in‐house reverse transcriptase PCR (RT–PCR) for PRRSV were conducted on nucleic acid extracts from BALF.
Frozen necropsy samples were utilized to assess tissue viral load. Approximately 500 mg of tissue or colon contents (feces) were placed in a 1·5‐ml pestle tube and homogenized in 300 μl of PBS with antibiotics. Subsequently, 200 μl of the tissue homogenate, serum, or nasal swab sample was then placed on confluent MDCK cells in 24‐well plates to incubate for 1 h. After 1 h of incubation, the sample was removed and 400‐μl MEM w/TPCK trypsin was added. The plate was checked at 24 and 48 h for cytopathic effects. After 48 h, 200 μl of cell culture supernatant from each well of the 24‐well plate was subsequently passed onto a confluent 48‐well plate after a freeze and thaw cycle. After 48 h, evidence of cytopathic effects was evaluated and presence of virus antigen confirmed by immuno‐cytochemical staining. Two replicates of tissue virus isolation were conducted. Virus titers in BALF and nasal swabs were determined on MDCK cells in 96‐well plates.
The MagMax Microarray (Ambion, Austin, TX, USA) protocol for RNA extraction from tissues was followed. Approximately 10 mg of each tissue was placed in a 1·5‐ml pestle tube and homogenized in 300 μl of PBS w/antibiotics. Tissue homogenate (100 μl) from above was added to bromo–chloro–propane (10 μl), incubated for 5 min at room temperature, centrifuged at 12 000 × g for 10 min at 4°C and 100 μl of the aqueous phase was transferred to the processing plate for MagMax RNA extraction as per manufacturer’s instructions. The MagMax Viral RNA Isolation (Ambion) kit protocol was used as per manufacturer’s instructions for serum, nasal swab, or BALF by adding 50 μl of serum, nasal swab, or BALF sample to the Mag Max plate for RNA extraction.
A TaqMan assay targeting the matrix gene was performed as previously described with modification as per the USDA–APHIS National Veterinary Services Laboratory protocol to increase sensitivity for the pandemic virus matrix gene by adding a pandemic H1N1 2009 matched reverse primer.
In experiment 2, 38 polyclonal antisera from pigs immunized with 19 H1 SIV isolated during 1999–2008 were tested against the pandemic viruses in a standard hemagglutination inhibition (HI) assay. 14 Each of the four phylogenetic clusters (α, β, γ, and δ) 8 , 9 of endemic North American H1 SIV were represented in the panel of sera as previously described 15 and with additional SIV isolates using the same methodology (A.L. Vincent, unpublished). Virus isolates used to generate antisera are listed in Table 3. Immunized pigs received intramuscular injections of 1 × 106 TCID50 per ml or approximately 64–128 HA units of UV‐inactivated influenza virus combined with a commercial adjuvant (Emulsigen D; MVP Laboratories, Inc., Ralston, NE, USA), followed by one or two booster doses 2–3 weeks apart until sufficient homologous HI titers were reached. For use in the HI assay, sera were heat inactivated at 56°C for 30 min, then treated to remove non‐specific HA inhibitors and natural serum agglutinins with receptor destroying enzyme followed by treatment with a 20% suspension of kaolin (Sigma Aldrich, St Louis, MO, USA) and adsorption with 0·5% turkey red blood cells (RBCs). The HI assays were then performed with the CA/09, NY/09, and MX/09 viruses as antigens and turkey RBC using standard techniques. 14 Additionally, 14 antisera from pigs immunized with five commercial vaccines or vaccines in the process of eventual licensure from the USDA–APHIS Center for Veterinary Biologics were tested against the pandemic H1N1 2009 viruses. Commercial vaccine antisera against either individual virus components or the combination of vaccines were supplied by the manufacturers for use in the study. Vaccine A (FluSure® XP; Pfizer Animal Health, New York, NY, USA) is a fully licensed trivalent commercial product containing cluster IV H3N2, γ‐cluster H1N1, and δ‐cluster H1N1 SIV as vaccine seed viruses. Vaccine B (MaxiVac Excell® 5.0; Intervet/Schering‐Plough, Boxmeer, the Netherlands) is a pentavalent product under review for full licensure containing clusters I and IV H3N2 and β‐, γ‐, and δ‐cluster H1 SIV. Vaccine C (Pneumostar® SIV; Novartis Animal Health, Basel, Switzerland) is a fully licensed bivalent commercial product containing H3N2 and α‐cluster H1N1, and a trivalent product that is under review for full licensure with the addition of a γ‐cluster H1 SIV to the H3N2 and α‐cluster H1N1 in the bivalent product. Vaccine D (Newport Labs, Worthington, MN, USA) is a bivalent autogenous vaccine containing β‐ and γ‐cluster H1 SIV. Vaccine E (Boehringer‐Ingelheim‐Vetmedica, St Joseph, MO, USA) is a subunit vaccine for H1 SIV in the research and development stage. The reported HI titer is the reciprocal of the highest dilution of serum where inhibition of viral agglutination of RBC was observed with a particular serum and virus pair.
To identify the Eurasian lineage matrix gene found in pandemic H1N1 2009 by RFLP analysis, isolated RNA was amplified by RT–PCR using forward primer 5′‐CATCCCGTCAGGCCCCCTCA and reverse primer 5′‐CATGGCCTCCGCTGCCTGTT in experiment 3. Specifically, 4 μl RNA was subjected to amplification by the One‐Step RT–PCR Kit (Qiagen, Valencia, CA, USA) using a final concentration of each primer at 0.6 μm with 5 units of RNase inhibitor (Invitrogen, Carlsbad, CA, USA) included in a total volume of 25 μl. Cycling conditions were as follows: 1 cycle of 50°C for 30 min followed by 95°C for 15 min; 35 cycles of 94°C for 30 s, 58°C for 40 s, and 72°C for 1 min; 1 cycle of 72°C for 10 min followed by a 4°C hold. After amplification, 17 μl was digested for 2 h with restriction endonuclease AlwNI under manufacturer’s suggested conditions (New England BioLabs, Ipswich, MA, USA). Digested samples were analyzed using a 1·2% agarose gel. Products migrated as an uncleaved 568‐bp fragment for endemic North American SIV matrix genes or as cleaved (40, 185, and 343 bp) fragments for the Eurasian SIV‐lineage matrix gene in the pandemic H1N1 2009.
The cross‐reactivity of the panel of swine H1 antisera against the three pandemic H1N1 2009 isolates is summarized in Table 3. A reciprocal HI titer for individual pig antiserum is reported for each virus isolate. Cross‐reactivity ranged from minimal to moderate among the three viral antigens based on reduction between the homologous and heterologous reciprocal HI titers. The greatest cross‐reactivity was demonstrated between A/Mexico/4108/2009 and antisera generated against SIV from the H1γ phylogenetic cluster. Cross‐reactivity with antisera from vaccinated pigs was limited against all three 2009 pandemic viral antigens.
An alignment of endemic swine influenza matrix gene nucleotide sequences with CA/09 (FJ966085, 972 bp) revealed two unique sites (nt 72 and 415) for restriction endonuclease AlwNI. To assess whether this site could be used to differentiate the novel H1N1 isolate from the present circulating SIV based on the matrix gene, a panel of 24 SIV isolated from cases of respiratory disease from US swine and three pandemic isolates were analyzed using the RFLP test. As shown in Figure 2, the M genes of none of the 24 viruses isolated from US swine were susceptible to digestion with AlwNI (lanes 1–24), whereas the M genes of all three human isolates were cleaved into 40, 185, and 343 bp fragments (lanes 25, 30, 31). RNA extracted directly from BALF from animals infected with CA/09 were also examined by this method (lanes 26–29) and produced identical results as the human isolates.
Although the pandemic H1N1 2009 viruses are genetically related to SIV of North American and Eurasian lineages, the constellation of the eight gene segments in the pandemic H1N1 2009 is not known to circulate widely in pigs. Additionally, the HA from the pandemic H1N1 viruses circulating in the human population are phylogenetically distinct from the nearest swine virus sequences. As the virulence of the pandemic H1N1 2009 in pigs was not known, we experimentally infected weaned pigs with one isolate of pandemic H1N1 2009, CA/09. We demonstrated that weaned pigs are susceptible to infection and clinical disease induced by CA/09. Importantly, the infection was characteristic of acute influenza illness in swine. Clinical signs, pathologic changes, and virus replication were restricted to the respiratory tract. The results reported here are consistent with recent reports of experimental infections with other strains of pandemic H1N1 virus, where pigs developed pyrexia, anorexia, and dyspnea within several days following challenge. 16 , 17 Likewise, there have been reports of swine becoming infected in the field with the pandemic H1N1 virus in which the pigs displayed mild respiratory disease (http://www.oie.int/eng/en_index.htm), similar to outbreaks with endemic SIV.
by Craig Lord - Swimming World Editor-in-Chief
Update: Further to our February 27 article pointing to research into the relationship between the Coronavirus (COVID-19) and water as far back as 2008, questions remain and caution is recommended by leading health organisations and relevant industry experts when it comes to how the virus can be transmitted.
Health authorities continue to urge caution when it comes to whether water can help transmit coronavirus (COVID-19), although water treatment companies are posting notices on company websites declaring that the virus at the core of a global health emergency “can be disinfected through use of ozone, chlorine and other treatment processes used in processing your tap water”.
While the latter appears to provide comfort for pool swimmers in narrow terms of the risk the actual water may pose, the European Centre For Disease Prevention And Control warned against complacency in the following terms:
“The rate at which a person can get COVID-19 by touching a contaminated surface or object (i.e., fomites) and then touching their own mouth, nose, or possibly their eyes is unclear.
“We also do not know if viral particles can be aerosolized from water or suspended into air after settling and remain infective. While such routes can occur for other coronaviruses, the European Centre for Disease Prevention and Control states that there is currently no evidence to support airborne transmission of the novel Coronavirus. A precautionary approach should be taken until studies eliminate other routes of transmission.
“Epidemiological studies also suggest that transmission rates of COVID-19 currently might be higher than those of SARS and MERS. Scientists have estimated that each person with the new Coronavirus could infect somewhere between 1.5 and 3.5 people without effective containment measures, according to [the paper] ‘Early Transmissibility Assessment of a Novel Coronavirus in Wuhan, China‘ [the source of the outbreak] in the Elsevier SSRN (Social Science Research Network).
Helix Water District, serving San Diego’s east county communities, is among operators in the water industry urging caution but also providing reassurances, such as this on its website:
“Coronavirus (COVID-19) is known to spread from person to person through close contact, similar to how the flu is transmitted. There is currently no evidence to support that Coronavirus (COVID-19) is transmitted through drinking water. Coronavirus (COVID-19) can be disinfected through use of ozone, chlorine and other treatment processes used in processing your tap water.”
Swimming World continues to monitor the situation while we await responses and further information from health authorities, including the World Health Organization (WHO), which told us a week ago:
“This is still a new virus and we are still gathering more epidemiological data to understand better the transmission. Based on the current data, we see that COVID-19 is transmitting mainly through respiratory droplets.”
Original article: published February 27, 2020
Research conducted at the University of Arizona more than 12 years ago has raised questions about whether the new coronavirus COVID-19 strain behind a global health emergency could be transferrable through water in the way that stomach ‘flu and other more common viruses are.
In Germany, a 47-year-old man is being cared for in isolation after testing positive for the virus during a four-day visit to a giant sub-tropical pools complex south of Berlin. The pool, with more than 1,000 visitors a day, remains open as its 91 staff undergo tests.
The new coronavirus is still being broken down by scientists to determine its nature and what might kill it off. However, previous coronavirus strains, research dating back to 2008 appear to show, have thrived in waters between 4C and 23C. It dies more rapidly in wastewater, researchers found.
Research by Patricia M Gundy, Principal Research Specialist, and Charles Gerba, Professor of epidemiology and bio-statistics in the Environmental Science Department at The University of Arizona in 2008 is summed up in the following abstract:
“The advent of severe acute respiratory syndrome and its potential environmental transmission indicates the need for more information on the survival of coronavirus in water and wastewater. The survival of representative coronaviruses, feline infectious peritonitis virus, and human coronavirus 229E was determined in filtered and unfiltered tap water (4 and 23°C) and wastewater (23°C). This was compared to poliovirus 1 under the same test conditions. Inactivation of coronaviruses in the test water was highly dependent on temperature, level of organic matter, and presence of antagonistic bacteria. The time required for the virus titer to decrease 99.9% (T99.9) shows that in tap water, coronaviruses are inactivated faster in water at 23°C (10days) than in water at 4°C (>100days). Coronaviruses die off rapidly in wastewater, with T99.9 values of between 2 and 4days. Poliovirus survived longer than coronaviruses in all test waters, except the 4°C tap water.”
The paper can be read in full by subscribers at Researchgate. We have reached out to the researchers for deeper understanding.
It is unclear whether the new virus can survive in water, what kind of water, what temperature of water, treated water and so forth. The answers may be critical to aquatic sports and others working in water environments.
Swimming World has asked several leading public health institutions, including the CDC in the United States, for guidance on the relationship between the virus and water. The responses focus on the novel nature of the current coronavirus and the infancy of the research process.
A spokesman for the Work Health Organisation told Swimming World:
“This is still a new virus and we are still gathering more epidemiological data to understand better the transmission. Based on the current data, we see that COVID-19 is transmitting mainly through respiratory droplets.”
Germany’s Public Health body, the Robert Koch Institute, is in charge of providing information on disinfectants/procedures in medical settings only. AS such it has no data related to the significance of the relationship between water and the coronavirus.
In general, however, a spokesperson for the Institute made the following point:
“Many features of SARS-CoV-2 are still not clear and need to be further investigated – it has been only 2 months since this virus has shown up, I’m not sure if anyone has addressed this question of pools yet in further depth.”
Swimming World will bring you more answers as and when we get them on that aspect of the virus.
Meanwhile, a real-life test case may be underway:
Attention turns to whether water – including tap water, pool water and open water, could play any significant part in the spread of the new coronavirus just as Germany contemplates the potential consequences of a single positive test returned by a man who went swimming at the giant, domed Tropical Islands leisure swimming pool complex south of Berlin.
On an average day, the vast complex hosts thousands of swimmers, including many tourists and travellers from further afield, inside and beyond Germany.
The man who now has the virus visited Tropical Islands with his family of five – and stayed for four days. The complex, with sub-tropical gardens, exotic birdlife, including flamingos, a large sauna and steam-room complex, restaurants and entertainment shows, has cabins and tents for hire for those who wish to stay overnight.
According to the Brandenburg Ministry of Health, the 47-year-old man from North Rhine-Westphalia is being cared for at the University Hospital in Düsseldorf. He left behind a deal of fear.
Today, 91 employees of the pool were tested for the virus, yet the complex remained open and was packed.
Tropical Islands in Germany – Photo Courtesy: Craig Lord
Kim Schäfer, Marketing Manager Tropical Islands, told the spa news agency: “Between February 20 to 23, we had between 3500-4000 guests per day because we were on vacation in Saxony. The people who worked on those days were still on duty when we got the news. Until the test result they are now free. With 1.2 million guests a year, we are one of the largest tourism organizations in Germany. The health authorities have been here all day, have examined our measures and evaluated that there is no danger for the visitors. Therefore we have remained open.”
Brandenburg’s Minister of Health Ursula Nonnemacher told media that the infected man had had no very close contacts with other bathers and that the authorities knew precisely who he had been in close contact with.
Other visitors have been told they need not but can submit themselves for testing if they wish. There has been no mention made of whether the environment at the complex and the many levels and temperatures of waters therein are significant or not.
In Hungary, the Bitskey Aladár swimming pool in Eger, in the north of the country, has been for an indefinite period as a precautionary measure after the local waterpolo team played a Champions League match in virus-hit Brescia, in northern Italy, last weekend.
Eger Mayor Ádám Mirkóczki told a press conference that he had taken the decision to close the pool following reports of coronavirus cases in northern Italy. He had asked the interior ministry for instructions for advice and they issued an instruction last Monday that the players and staff members returning from Brescia should not be allowed to use the swimming pool until further notice.
However, the health authority ÁNTSZ informed the club on Tuesday afternoon that the pool was open again, just to the players, for training and upcoming games, Mirkóczki added before saying he was “appalled” that the players had not been tested for the virus.
A vast array of pharmaceuticals — including antibiotics, anti-convulsants, mood stabilizers and sex hormones — have been found in the drinking water supplies of at least 41 million Americans, an Associated Press investigation shows.
To be sure, the concentrations of these pharmaceuticals are tiny, measured in quantities of parts per billion or trillion, far below the levels of a medical dose. Also, utilities insist their water is safe.
But the presence of so many prescription drugs — and over-the-counter medicines like acetaminophen and ibuprofen — in so much of our drinking water is heightening worries among scientists of long-term consequences to human health.
In the course of a five-month inquiry, the AP discovered that drugs have been detected in the drinking water supplies of 24 major metropolitan areas — from Southern California to Northern New Jersey, from Detroit to Louisville, Ky.
Water providers rarely disclose results of pharmaceutical screenings, unless pressed, the AP found. For example, the head of a group representing major California suppliers said the public "doesn't know how to interpret the information" and might be unduly alarmed.
How do the drugs get into the water?
People take pills. Their bodies absorb some of the medication, but the rest of it passes through and is flushed down the toilet. The wastewater is treated before it is discharged into reservoirs, rivers or lakes. Then, some of the water is cleansed again at drinking water treatment plants and piped to consumers. But most treatments do not remove all drug residue.
And while researchers do not yet understand the exact risks from decades of persistent exposure to random combinations of low levels of pharmaceuticals, recent studies — which have gone virtually unnoticed by the general public — have found alarming effects on human cells and wildlife.
"We recognize it is a growing concern and we're taking it very seriously," said Benjamin H. Grumbles, assistant administrator for water at the U.S. Environmental Protection Agency.
Members of the AP National Investigative Team reviewed hundreds of scientific reports, analyzed federal drinking water databases, visited environmental study sites and treatment plants and interviewed more than 230 officials, academics and scientists. They also surveyed the nation's 50 largest cities and a dozen other major water providers, as well as smaller community water providers in all 50 states.
Here are some of the key test results obtained by the AP:
_Officials in Philadelphia said testing there discovered 56 pharmaceuticals or byproducts in treated drinking water, including medicines for pain, infection, high cholesterol, asthma, epilepsy, mental illness and heart problems. Sixty-three pharmaceuticals or byproducts were found in the city's watersheds.
_Anti-epileptic and anti-anxiety medications were detected in a portion of the treated drinking water for 18.5 million people in Southern California.
_Researchers at the U.S. Geological Survey analyzed a Passaic Valley Water Commission drinking water treatment plant, which serves 850,000 people in Northern New Jersey, and found a metabolized angina medicine and the mood-stabilizing carbamazepine in drinking water.
_A sex hormone was detected in San Francisco's drinking water.
_The drinking water for Washington, D.C., and surrounding areas tested positive for six pharmaceuticals.
_Three medications, including an antibiotic, were found in drinking water supplied to Tucson, Ariz.
The situation is undoubtedly worse than suggested by the positive test results in the major population centers documented by the AP.
The federal government doesn't require any testing and hasn't set safety limits for drugs in water. Of the 62 major water providers contacted, the drinking water for only 28 was tested. Among the 34 that haven't: Houston, Chicago, Miami, Baltimore, Phoenix, Boston and New York City's Department of Environmental Protection, which delivers water to 9 million people.
Some providers screen only for one or two pharmaceuticals, leaving open the possibility that others are present.
The AP's investigation also indicates that watersheds, the natural sources of most of the nation's water supply, also are contaminated. Tests were conducted in the watersheds of 35 of the 62 major providers surveyed by the AP, and pharmaceuticals were detected in 28.
Yet officials in six of those 28 metropolitan areas said they did not go on to test their drinking water — Fairfax, Va.; Montgomery County in Maryland; Omaha, Neb.; Oklahoma City; Santa Clara, Calif., and New York City.
The New York state health department and the USGS tested the source of the city's water, upstate. They found trace concentrations of heart medicine, infection fighters, estrogen, anti-convulsants, a mood stabilizer and a tranquilizer.
City water officials declined repeated requests for an interview. In a statement, they insisted that "New York City's drinking water continues to meet all federal and state regulations regarding drinking water quality in the watershed and the distribution system" — regulations that do not address trace pharmaceuticals.
In several cases, officials at municipal or regional water providers told the AP that pharmaceuticals had not been detected, but the AP obtained the results of tests conducted by independent researchers that showed otherwise. For example, water department officials in New Orleans said their water had not been tested for pharmaceuticals, but a Tulane University researcher and his students have published a study that found the pain reliever naproxen, the sex hormone estrone and the anti-cholesterol drug byproduct clofibric acid in treated drinking water.
Of the 28 major metropolitan areas where tests were performed on drinking water supplies, only Albuquerque; Austin, Texas; and Virginia Beach, Va.; said tests were negative. The drinking water in Dallas has been tested, but officials are awaiting results. Arlington, Texas, acknowledged that traces of a pharmaceutical were detected in its drinking water but cited post-9/11 security concerns in refusing to identify the drug.
The AP also contacted 52 small water providers — one in each state, and two each in Missouri and Texas — that serve communities with populations around 25,000. All but one said their drinking water had not been screened for pharmaceuticals; officials in Emporia, Kan., refused to answer AP's questions, also citing post-9/11 issues.
Rural consumers who draw water from their own wells aren't in the clear either, experts say.
The Stroud Water Research Center, in Avondale, Pa., has measured water samples from New York City's upstate watershed for caffeine, a common contaminant that scientists often look for as a possible signal for the presence of other pharmaceuticals. Though more caffeine was detected at suburban sites, researcher Anthony Aufdenkampe was struck by the relatively high levels even in less populated areas.
He suspects it escapes from failed septic tanks, maybe with other drugs. "Septic systems are essentially small treatment plants that are essentially unmanaged and therefore tend to fail," Aufdenkampe said.
Even users of bottled water and home filtration systems don't necessarily avoid exposure. Bottlers, some of which simply repackage tap water, do not typically treat or test for pharmaceuticals, according to the industry's main trade group. The same goes for the makers of home filtration systems.
Contamination is not confined to the United States. More than 100 different pharmaceuticals have been detected in lakes, rivers, reservoirs and streams throughout the world. Studies have detected pharmaceuticals in waters throughout Asia, Australia, Canada and Europe — even in Swiss lakes and the North Sea.
For example, in Canada, a study of 20 Ontario drinking water treatment plants by a national research institute found nine different drugs in water samples. Japanese health officials in December called for human health impact studies after detecting prescription drugs in drinking water at seven different sites.
In the United States, the problem isn't confined to surface waters. Pharmaceuticals also permeate aquifers deep underground, source of 40 percent of the nation's water supply. Federal scientists who drew water in 24 states from aquifers near contaminant sources such as landfills and animal feed lots found minuscule levels of hormones, antibiotics and other drugs.
Perhaps it's because Americans have been taking drugs — and flushing them unmetabolized or unused — in growing amounts. Over the past five years, the number of U.S. prescriptions rose 12 percent to a record 3.7 billion, while nonprescription drug purchases held steady around 3.3 billion, according to IMS Health and The Nielsen Co.
"People think that if they take a medication, their body absorbs it and it disappears, but of course that's not the case," said EPA scientist Christian Daughton, one of the first to draw attention to the issue of pharmaceuticals in water in the United States.
Some drugs, including widely used cholesterol fighters, tranquilizers and anti-epileptic medications, resist modern drinking water and wastewater treatment processes. Plus, the EPA says there are no sewage treatment systems specifically engineered to remove pharmaceuticals.
One technology, reverse osmosis, removes virtually all pharmaceutical contaminants but is very expensive for large-scale use and leaves several gallons of polluted water for every one that is made drinkable.
Another issue: There's evidence that adding chlorine, a common process in conventional drinking water treatment plants, makes some pharmaceuticals more toxic.
Human waste isn't the only source of contamination. Cattle, for example, are given ear implants that provide a slow release of trenbolone, an anabolic steroid used by some bodybuilders, which causes cattle to bulk up. But not all the trenbolone circulating in a steer is metabolized. A German study showed 10 percent of the steroid passed right through the animals.
Water sampled downstream of a Nebraska feedlot had steroid levels four times as high as the water taken upstream. Male fathead minnows living in that downstream area had low testosterone levels and small heads.
Other veterinary drugs also play a role. Pets are now treated for arthritis, cancer, heart disease, diabetes, allergies, dementia, and even obesity — sometimes with the same drugs as humans. The inflation-adjusted value of veterinary drugs rose by 8 percent, to $5.2 billion, over the past five years, according to an analysis of data from the Animal Health Institute.
Ask the pharmaceutical industry whether the contamination of water supplies is a problem, and officials will tell you no. "Based on what we now know, I would say we find there's little or no risk from pharmaceuticals in the environment to human health," said microbiologist Thomas White, a consultant for the Pharmaceutical Research and Manufacturers of America.
But at a conference last summer, Mary Buzby — director of environmental technology for drug maker Merck & Co. Inc. — said: "There's no doubt about it, pharmaceuticals are being detected in the environment and there is genuine concern that these compounds, in the small concentrations that they're at, could be causing impacts to human health or to aquatic organisms."
Recent laboratory research has found that small amounts of medication have affected human embryonic kidney cells, human blood cells and human breast cancer cells. The cancer cells proliferated too quickly; the kidney cells grew too slowly; and the blood cells showed biological activity associated with inflammation.
Also, pharmaceuticals in waterways are damaging wildlife across the nation and around the globe, research shows. Notably, male fish are being feminized, creating egg yolk proteins, a process usually restricted to females. Pharmaceuticals also are affecting sentinel species at the foundation of the pyramid of life — such as earth worms in the wild and zooplankton in the laboratory, studies show.
Some scientists stress that the research is extremely limited, and there are too many unknowns. They say, though, that the documented health problems in wildlife are disconcerting.
"It brings a question to people's minds that if the fish were affected ... might there be a potential problem for humans?" EPA research biologist Vickie Wilson told the AP. "It could be that the fish are just exquisitely sensitive because of their physiology or something. We haven't gotten far enough along."
With limited research funds, said Shane Snyder, research and development project manager at the Southern Nevada Water Authority, a greater emphasis should be put on studying the effects of drugs in water.
"I think it's a shame that so much money is going into monitoring to figure out if these things are out there, and so little is being spent on human health," said Snyder. "They need to just accept that these things are everywhere — every chemical and pharmaceutical could be there. It's time for the EPA to step up to the plate and make a statement about the need to study effects, both human and environmental."
To the degree that the EPA is focused on the issue, it appears to be looking at detection. Grumbles acknowledged that just late last year the agency developed three new methods to "detect and quantify pharmaceuticals" in wastewater. "We realize that we have a limited amount of data on the concentrations," he said. "We're going to be able to learn a lot more."
While Grumbles said the EPA had analyzed 287 pharmaceuticals for possible inclusion on a draft list of candidates for regulation under the Safe Drinking Water Act, he said only one, nitroglycerin, was on the list. Nitroglycerin can be used as a drug for heart problems, but the key reason it's being considered is its widespread use in making explosives.
So much is unknown. Many independent scientists are skeptical that trace concentrations will ultimately prove to be harmful to humans. Confidence about human safety is based largely on studies that poison lab animals with much higher amounts.
There's growing concern in the scientific community, meanwhile, that certain drugs — or combinations of drugs — may harm humans over decades because water, unlike most specific foods, is consumed in sizable amounts every day.
Our bodies may shrug off a relatively big one-time dose, yet suffer from a smaller amount delivered continuously over a half century, perhaps subtly stirring allergies or nerve damage. Pregnant women, the elderly and the very ill might be more sensitive.
Many concerns about chronic low-level exposure focus on certain drug classes: chemotherapy that can act as a powerful poison; hormones that can hamper reproduction or development; medicines for depression and epilepsy that can damage the brain or change behavior; antibiotics that can allow human germs to mutate into more dangerous forms; pain relievers and blood-pressure diuretics.
For several decades, federal environmental officials and nonprofit watchdog environmental groups have focused on regulated contaminants — pesticides, lead, PCBs — which are present in higher concentrations and clearly pose a health risk.
However, some experts say medications may pose a unique danger because, unlike most pollutants, they were crafted to act on the human body.
"These are chemicals that are designed to have very specific effects at very low concentrations. That's what pharmaceuticals do. So when they get out to the environment, it should not be a shock to people that they have effects," says zoologist John Sumpter at Brunel University in London, who has studied trace hormones, heart medicine and other drugs.
And while drugs are tested to be safe for humans, the timeframe is usually over a matter of months, not a lifetime. Pharmaceuticals also can produce side effects and interact with other drugs at normal medical doses. That's why — aside from therapeutic doses of fluoride injected into potable water supplies — pharmaceuticals are prescribed to people who need them, not delivered to everyone in their drinking water.
"We know we are being exposed to other people's drugs through our drinking water, and that can't be good," says Dr. David Carpenter, who directs the Institute for Health and the Environment of the State University of New York at Albany.
(EnserinkMar, M., StoneMar, R., CohenMar, J., NormileMar, D., Couzin-FrankelMar, J., Brugger, K., … Ortega, R. P. (2017, December 10). Researchers Turn Mosquitoes Into Flying Vaccinators. Retrieved from https://www.sciencemag.org/news/2010/03/researchers-turn-mosquitoes-flying-vaccinators )
By Martin EnserinkMar. 18, 2010 , 8:00 PM
Here's a study to file under "unworkable but very cool." A group of Japanese researchers has developed a mosquito that spreads vaccine instead of disease. Even the researchers admit, however, that regulatory and ethical problems will prevent the critters from ever taking wing—at least for the delivery of human vaccines.
Scientists have dreamed up various ways to tinker with insects' DNA to fight disease. One option is to create strains of mosquitoes that are resistant to infections with parasites or viruses, or that are unable to pass the pathogens on to humans. These would somehow have to replace the natural, disease-bearing mosquitoes, which is a tall order. Another strategy closer to becoming reality is to release transgenic mosquitoes that, when they mate with wild-type counterparts, don't produce viable offspring. That would shrink the population over time.
The new study relies on a very different mechanism: Use mosquitoes to become what the scientists call "flying vaccinators." Normally, when mosquitoes bite, they inject a tiny drop of saliva that prevents the host's blood from clotting. The Japanese group decided to add an antigen-a compound that triggers an immune response-to the mix of proteins in the insect's saliva.A group by led by molecular geneticist Shigeto Yoshida of Jichi Medical University in Tochigi, Japan, identified a region in the genome of Anopheles stephensi-a malaria mosquito-called a promoter that turns on genes only in the insects' saliva. To this promoter they attached SP15, a candidate vaccine against leishmaniasis, a parasitic disease spread by sand flies that can cause skin sores and organ damage. Sure enough, the mosquitoes produced SP15 in their saliva, the team reports in the current issue of Insect Molecular Biology. And when the insects were allowed to feast on mice, the mice developed antibodies against SP15.
Antibody levels weren't very high, and the team has yet to test whether they protect the rodents against the disease. (Only very few labs have the facilities for so-called challenge studies with that disease, says Yoshida.) In the experiment, mice were bitten some 1500 times on average; that may seem very high, but studies show that in places where malaria is rampant, people get bitten more than 100 times a night, Yoshida points out. In the meantime, the group has also made mosquitoes produce a candidate malaria vaccine.
Other researchers are wowed by the achievement. "The science is really beautiful," says Jesus Valenzuela of the National Institute of Allergy and Infectious Diseases in Bethesda, Maryland, who developed the SP15 vaccine. David O'Brochta, an insect molecular geneticist at the University of Maryland, College Park, calls it "a fascinating proof of concept."
So why won't it fly? There's a huge variation in the number of mosquito bites one person received compared with the next, so people exposed to the transgenic mosquitoes would get vastly different doses of the vaccine; it would be a bit like giving some people one measles jab and others 500 of them. No regulatory agency would sign off on that, says molecular biologist Robert Sinden of Imperial College London. Releasing the mosquitoes would also mean vaccinating people without their informed consent, an ethical no-no. Yoshida concedes that the mosquito would be "unacceptable" as a human vaccine-delivery mechanism.
However, flying vaccinators-or "flying syringes" as some have dubbed them -may have potential in fighting animal disease, says O'Brochta. Animals don't need to give their consent, and the variable dosage would be less of a concern.
2020-03-08 16:51:55
2020-03-08 16:53:02
2020-03-08 16:53:40
2020-03-08 16:54:08
2020-03-08 16:54:40
2020-03-08 16:55:05
2020-03-08 16:55:36
2020-03-08 16:56:01
2020-03-08 16:56:42
2020-03-08 16:57:10
2020-03-08 16:57:33
2020-03-08 16:59:35
2020-03-08 17:00:26
2020-03-08 17:00:55
2020-03-08 17:02:01
2020-03-08 17:02:43
2020-03-08 17:03:04
2020-03-08 17:03:26
2020-03-08 17:03:54
2020-03-08 17:04:17
2020-03-08 17:05:03
2020-03-08 17:05:30
2020-03-08 17:05:56
2020-03-08 17:06:30
2020-03-08 17:06:58
2020-03-08 17:07:18
2020-03-08 17:07:43
2020-03-08 17:08:20
2020-03-08 17:09:07
2020-03-08 17:09:28
2020-03-08 17:09:47
2020-03-08 17:10:11
2020-03-08 17:11:32
2020-03-08 17:12:13
2020-03-08 17:12:59
2020-03-08 17:13:41
